ID: 985734967

View in Genome Browser
Species Human (GRCh38)
Location 5:1574186-1574208
Sequence TCCTATGTGGACGTTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734967_985734977 29 Left 985734967 5:1574186-1574208 CCAGTGCCAACGTCCACATAGGA No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734967_985734972 9 Left 985734967 5:1574186-1574208 CCAGTGCCAACGTCCACATAGGA No data
Right 985734972 5:1574218-1574240 CTTCCTCCAGTGCTCCTCAAAGG No data
985734967_985734973 10 Left 985734967 5:1574186-1574208 CCAGTGCCAACGTCCACATAGGA No data
Right 985734973 5:1574219-1574241 TTCCTCCAGTGCTCCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734967 Original CRISPR TCCTATGTGGACGTTGGCAC TGG (reversed) Intergenic
No off target data available for this crispr