ID: 985734970

View in Genome Browser
Species Human (GRCh38)
Location 5:1574192-1574214
Sequence ACCCTGTCCTATGTGGACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734970_985734977 23 Left 985734970 5:1574192-1574214 CCAACGTCCACATAGGACAGGGT No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734970_985734979 28 Left 985734970 5:1574192-1574214 CCAACGTCCACATAGGACAGGGT No data
Right 985734979 5:1574243-1574265 TTCTTCTGTTGCCCCTGGATGGG No data
985734970_985734978 27 Left 985734970 5:1574192-1574214 CCAACGTCCACATAGGACAGGGT No data
Right 985734978 5:1574242-1574264 CTTCTTCTGTTGCCCCTGGATGG No data
985734970_985734973 4 Left 985734970 5:1574192-1574214 CCAACGTCCACATAGGACAGGGT No data
Right 985734973 5:1574219-1574241 TTCCTCCAGTGCTCCTCAAAGGG No data
985734970_985734972 3 Left 985734970 5:1574192-1574214 CCAACGTCCACATAGGACAGGGT No data
Right 985734972 5:1574218-1574240 CTTCCTCCAGTGCTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734970 Original CRISPR ACCCTGTCCTATGTGGACGT TGG (reversed) Intergenic
No off target data available for this crispr