ID: 985734974

View in Genome Browser
Species Human (GRCh38)
Location 5:1574221-1574243
Sequence AGCCCTTTGAGGAGCACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734974_985734978 -2 Left 985734974 5:1574221-1574243 CCTCCAGTGCTCCTCAAAGGGCT No data
Right 985734978 5:1574242-1574264 CTTCTTCTGTTGCCCCTGGATGG No data
985734974_985734979 -1 Left 985734974 5:1574221-1574243 CCTCCAGTGCTCCTCAAAGGGCT No data
Right 985734979 5:1574243-1574265 TTCTTCTGTTGCCCCTGGATGGG No data
985734974_985734980 4 Left 985734974 5:1574221-1574243 CCTCCAGTGCTCCTCAAAGGGCT No data
Right 985734980 5:1574248-1574270 CTGTTGCCCCTGGATGGGCTTGG No data
985734974_985734977 -6 Left 985734974 5:1574221-1574243 CCTCCAGTGCTCCTCAAAGGGCT No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734974 Original CRISPR AGCCCTTTGAGGAGCACTGG AGG (reversed) Intergenic
No off target data available for this crispr