ID: 985734975

View in Genome Browser
Species Human (GRCh38)
Location 5:1574224-1574246
Sequence AGAAGCCCTTTGAGGAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734975_985734977 -9 Left 985734975 5:1574224-1574246 CCAGTGCTCCTCAAAGGGCTTCT No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734975_985734979 -4 Left 985734975 5:1574224-1574246 CCAGTGCTCCTCAAAGGGCTTCT No data
Right 985734979 5:1574243-1574265 TTCTTCTGTTGCCCCTGGATGGG No data
985734975_985734980 1 Left 985734975 5:1574224-1574246 CCAGTGCTCCTCAAAGGGCTTCT No data
Right 985734980 5:1574248-1574270 CTGTTGCCCCTGGATGGGCTTGG No data
985734975_985734978 -5 Left 985734975 5:1574224-1574246 CCAGTGCTCCTCAAAGGGCTTCT No data
Right 985734978 5:1574242-1574264 CTTCTTCTGTTGCCCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734975 Original CRISPR AGAAGCCCTTTGAGGAGCAC TGG (reversed) Intergenic