ID: 985734977

View in Genome Browser
Species Human (GRCh38)
Location 5:1574238-1574260
Sequence AGGGCTTCTTCTGTTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734975_985734977 -9 Left 985734975 5:1574224-1574246 CCAGTGCTCCTCAAAGGGCTTCT No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734970_985734977 23 Left 985734970 5:1574192-1574214 CCAACGTCCACATAGGACAGGGT No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734965_985734977 30 Left 985734965 5:1574185-1574207 CCCAGTGCCAACGTCCACATAGG No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734971_985734977 16 Left 985734971 5:1574199-1574221 CCACATAGGACAGGGTGTGCTTC No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734974_985734977 -6 Left 985734974 5:1574221-1574243 CCTCCAGTGCTCCTCAAAGGGCT No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data
985734967_985734977 29 Left 985734967 5:1574186-1574208 CCAGTGCCAACGTCCACATAGGA No data
Right 985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734977 Original CRISPR AGGGCTTCTTCTGTTGCCCC TGG Intergenic
No off target data available for this crispr