ID: 985734978

View in Genome Browser
Species Human (GRCh38)
Location 5:1574242-1574264
Sequence CTTCTTCTGTTGCCCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985734970_985734978 27 Left 985734970 5:1574192-1574214 CCAACGTCCACATAGGACAGGGT No data
Right 985734978 5:1574242-1574264 CTTCTTCTGTTGCCCCTGGATGG No data
985734971_985734978 20 Left 985734971 5:1574199-1574221 CCACATAGGACAGGGTGTGCTTC No data
Right 985734978 5:1574242-1574264 CTTCTTCTGTTGCCCCTGGATGG No data
985734975_985734978 -5 Left 985734975 5:1574224-1574246 CCAGTGCTCCTCAAAGGGCTTCT No data
Right 985734978 5:1574242-1574264 CTTCTTCTGTTGCCCCTGGATGG No data
985734974_985734978 -2 Left 985734974 5:1574221-1574243 CCTCCAGTGCTCCTCAAAGGGCT No data
Right 985734978 5:1574242-1574264 CTTCTTCTGTTGCCCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985734978 Original CRISPR CTTCTTCTGTTGCCCCTGGA TGG Intergenic
No off target data available for this crispr