ID: 985736089

View in Genome Browser
Species Human (GRCh38)
Location 5:1584151-1584173
Sequence CTTACAATGTAAAACTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985736089_985736093 25 Left 985736089 5:1584151-1584173 CCCACCAAGTTTTACATTGTAAG No data
Right 985736093 5:1584199-1584221 GAGTAAGAGTGTCCGTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985736089 Original CRISPR CTTACAATGTAAAACTTGGT GGG (reversed) Intergenic
No off target data available for this crispr