ID: 985737276

View in Genome Browser
Species Human (GRCh38)
Location 5:1591504-1591526
Sequence TAGGGAAGAAAAGGGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985737276_985737283 18 Left 985737276 5:1591504-1591526 CCAGCAATCCCTTTTCTTCCCTA No data
Right 985737283 5:1591545-1591567 TGTCGTATCAACAGAACCACAGG 0: 2
1: 0
2: 1
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985737276 Original CRISPR TAGGGAAGAAAAGGGATTGC TGG (reversed) Intergenic
No off target data available for this crispr