ID: 985739013

View in Genome Browser
Species Human (GRCh38)
Location 5:1603926-1603948
Sequence CTTCCCAAGGGGAAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985739013_985739022 4 Left 985739013 5:1603926-1603948 CCTCCCAACTTCCCCTTGGGAAG No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739013_985739026 27 Left 985739013 5:1603926-1603948 CCTCCCAACTTCCCCTTGGGAAG No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739013_985739021 3 Left 985739013 5:1603926-1603948 CCTCCCAACTTCCCCTTGGGAAG No data
Right 985739021 5:1603952-1603974 CCACCCTCCAGCAGTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985739013 Original CRISPR CTTCCCAAGGGGAAGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr