ID: 985739022

View in Genome Browser
Species Human (GRCh38)
Location 5:1603953-1603975
Sequence CACCCTCCAGCAGTTTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985739010_985739022 12 Left 985739010 5:1603918-1603940 CCTGAGCACCTCCCAACTTCCCC No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739018_985739022 -9 Left 985739018 5:1603939-1603961 CCTTGGGAAGATCCCACCCTCCA No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739013_985739022 4 Left 985739013 5:1603926-1603948 CCTCCCAACTTCCCCTTGGGAAG No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739015_985739022 0 Left 985739015 5:1603930-1603952 CCAACTTCCCCTTGGGAAGATCC No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739014_985739022 1 Left 985739014 5:1603929-1603951 CCCAACTTCCCCTTGGGAAGATC No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739016_985739022 -7 Left 985739016 5:1603937-1603959 CCCCTTGGGAAGATCCCACCCTC No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739017_985739022 -8 Left 985739017 5:1603938-1603960 CCCTTGGGAAGATCCCACCCTCC No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data
985739009_985739022 24 Left 985739009 5:1603906-1603928 CCATTTGCTCTGCCTGAGCACCT No data
Right 985739022 5:1603953-1603975 CACCCTCCAGCAGTTTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985739022 Original CRISPR CACCCTCCAGCAGTTTTGCA GGG Intergenic
No off target data available for this crispr