ID: 985739026

View in Genome Browser
Species Human (GRCh38)
Location 5:1603976-1603998
Sequence AAGCTGTGCTCTTCCCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 7, 1: 9, 2: 2, 3: 28, 4: 302}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985739015_985739026 23 Left 985739015 5:1603930-1603952 CCAACTTCCCCTTGGGAAGATCC No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739018_985739026 14 Left 985739018 5:1603939-1603961 CCTTGGGAAGATCCCACCCTCCA No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739019_985739026 2 Left 985739019 5:1603951-1603973 CCCACCCTCCAGCAGTTTTGCAG No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739016_985739026 16 Left 985739016 5:1603937-1603959 CCCCTTGGGAAGATCCCACCCTC No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739025_985739026 -6 Left 985739025 5:1603959-1603981 CCAGCAGTTTTGCAGGGAAGCTG No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739024_985739026 -3 Left 985739024 5:1603956-1603978 CCTCCAGCAGTTTTGCAGGGAAG No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739020_985739026 1 Left 985739020 5:1603952-1603974 CCACCCTCCAGCAGTTTTGCAGG No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739017_985739026 15 Left 985739017 5:1603938-1603960 CCCTTGGGAAGATCCCACCCTCC No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739013_985739026 27 Left 985739013 5:1603926-1603948 CCTCCCAACTTCCCCTTGGGAAG No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739023_985739026 -2 Left 985739023 5:1603955-1603977 CCCTCCAGCAGTTTTGCAGGGAA No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302
985739014_985739026 24 Left 985739014 5:1603929-1603951 CCCAACTTCCCCTTGGGAAGATC No data
Right 985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG 0: 7
1: 9
2: 2
3: 28
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985739026 Original CRISPR AAGCTGTGCTCTTCCCACAA AGG Intergenic
902659995 1:17894306-17894328 AAGCTGTGCTCTTTCTGCGAAGG + Intergenic
902943525 1:19817039-19817061 AAGCTGTGCTCTGTCCACCTTGG + Intergenic
904307454 1:29599324-29599346 AGGCTGAGCTCTACCCACCATGG + Intergenic
905059803 1:35130207-35130229 AAGCTGTGCTCTGACCACCTTGG - Intergenic
905283505 1:36864362-36864384 AAGCTGAGCTCTGCCTACAGGGG + Intronic
906817316 1:48892461-48892483 AAGCTGTGCTCTGACCACCTTGG - Intronic
907462935 1:54616019-54616041 GTGCTGGGCTCTTCCCAAAAGGG - Exonic
907495196 1:54839087-54839109 AAGCTGTGTTCTTTCCTCAAGGG + Intronic
908268527 1:62401262-62401284 AAGCTGTGCTCAAACCACAGGGG + Intergenic
911985942 1:104621896-104621918 AAGCTGTGCTCTAACCACCTTGG - Intergenic
912285496 1:108364469-108364491 AACCTGGGCTGCTCCCACAAAGG - Intergenic
915652395 1:157325602-157325624 AAGCTGTGCCCTGACCACATTGG + Intergenic
916619368 1:166479235-166479257 TAGCTGTGATTTTCCCAGAATGG - Intergenic
916940466 1:169671608-169671630 AAACTGTCCCCTCCCCACAAAGG - Intronic
917099391 1:171430366-171430388 AAGCTGTGCTCTGACCACCTTGG + Intergenic
917636567 1:176942904-176942926 AAGCTGTGCCCTTACCACCTTGG + Intronic
920132592 1:203744271-203744293 AAGCTGTGCTCCACCCACCTTGG + Intergenic
921014618 1:211177081-211177103 AAGCTGTGCTCTGACCACCTTGG + Intergenic
923185345 1:231567795-231567817 AATGTGTTCTCTTACCACAATGG + Intronic
924109836 1:240687909-240687931 GATCTGTGCTCTTGGCACAACGG + Intergenic
924134255 1:240947119-240947141 ATGCAGTACTCTTCCCACCAGGG - Intronic
924774310 1:247105005-247105027 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1062922262 10:1289323-1289345 AAGCTGTGCTCCGACCACACTGG + Intronic
1064704469 10:18057707-18057729 AAGCTGTGCTCTGCCCACCTTGG - Intergenic
1065328453 10:24570392-24570414 AAGCTGTGCTCTGGGCAGAAAGG + Intergenic
1066054267 10:31665873-31665895 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1067119055 10:43458226-43458248 AAAGTGTGCTCTGCCCACATTGG - Intronic
1067409778 10:46054276-46054298 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1068942147 10:62690656-62690678 ACCCTGTCCTCTTCCCACAAGGG + Intergenic
1069300362 10:66899909-66899931 GAGCTATGCCCTGCCCACAAAGG - Intronic
1070301496 10:75207173-75207195 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1070587270 10:77775725-77775747 CAGGTGTGCTCATCCCTCAAGGG - Intergenic
1070790864 10:79188573-79188595 AAGCTGGGCTCTGGCCACAAAGG - Intronic
1071898569 10:90092574-90092596 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1071930514 10:90464525-90464547 AAGCTGTGCTCTAGGCAGAATGG - Intergenic
1072216592 10:93292375-93292397 AAGCTGTGCTCTGACCACCCTGG - Intergenic
1072401835 10:95110871-95110893 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1072714402 10:97740346-97740368 TCACTGTGCTCTTCCCACAAGGG + Intronic
1073998094 10:109339219-109339241 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1075976629 10:126701735-126701757 CAACTGTGCTCTTCCCACCCAGG + Intergenic
1079079001 11:17401080-17401102 AAGCTGGGATCTGCACACAAGGG + Intronic
1080833512 11:35918466-35918488 AAGTTGTCCTTTTCCCACTAGGG - Intergenic
1081324783 11:41730696-41730718 AAGCTGTGCCCCTACCACATTGG - Intergenic
1081351105 11:42053307-42053329 GTGGTGTACTCTTCCCACAATGG + Intergenic
1081797840 11:45833955-45833977 AAGCTGTGCCCTGCCCACATTGG - Intergenic
1082272552 11:50187413-50187435 CAGCTGTTCACTTCCCATAAGGG + Intergenic
1083190619 11:61049467-61049489 AAAGTGTCCTCTTCCCACAGTGG - Intergenic
1084051877 11:66605467-66605489 AAGCTGTCGTCTCCCCTCAAAGG + Exonic
1084150445 11:67285682-67285704 GGGCTGTGCTCTTCCCCCACAGG - Exonic
1087039991 11:93789398-93789420 ATTCTGTGCTTTTCCCAGAAGGG + Intronic
1087047354 11:93853145-93853167 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1087049597 11:93872035-93872057 AAACTGTGCTCTTACCACTTTGG - Intergenic
1087050175 11:93878869-93878891 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1087207903 11:95416583-95416605 AGGCTGGGCTCTTTCCACTATGG + Intergenic
1089072563 11:115711579-115711601 GAGGCCTGCTCTTCCCACAAGGG + Intergenic
1089882511 11:121788263-121788285 CAGCTTTGCTGCTCCCACAAGGG + Intergenic
1090946986 11:131439392-131439414 CAGCTATGCCCTACCCACAAAGG + Intronic
1091030662 11:132184605-132184627 AAGCCTGGCTCTTCCCTCAATGG + Intronic
1093028775 12:14268900-14268922 AAGCTGTATTCTTCCCACCTTGG + Intergenic
1093072114 12:14716424-14716446 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1093708847 12:22306213-22306235 AAGCTGTGCTCTGACCACCTTGG + Intronic
1093732065 12:22576181-22576203 AAGCTTTCTTTTTCCCACAATGG - Intergenic
1095140581 12:38657436-38657458 CAGCTGTGCCCTACCCACAGAGG - Intronic
1095855770 12:46859537-46859559 AAGCTGTGCTCTTATCACCTTGG - Intergenic
1096631191 12:52927638-52927660 AGGCTCGGCTCTGCCCACAAGGG - Intronic
1098827167 12:75310838-75310860 AAGCAGTGTTCTTCTCTCAAAGG + Intronic
1100808319 12:98311282-98311304 CAGCTATGCTCTTCCCACAGAGG - Intergenic
1100816673 12:98393485-98393507 AAGCTGTGTTCTTCCCTCTGGGG - Intergenic
1100816966 12:98396017-98396039 AAGCTGTGTTCTTCCCTCTGGGG - Intergenic
1102997268 12:117360478-117360500 AAGTTGTGCTTCTCCCGCAAAGG - Intronic
1104066614 12:125312041-125312063 AGCCTGTGCTCTGCCTACAAGGG + Intronic
1106508191 13:30390107-30390129 AAGCTGTGCTTTCCCGAGAAAGG - Intergenic
1107022740 13:35767902-35767924 AAGCTGTGCTCTTCCTTAGAAGG - Intergenic
1108316836 13:49244705-49244727 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1109385896 13:61628902-61628924 CAGCTGTGCCCTGCCCACAGAGG + Intergenic
1109696093 13:65960324-65960346 AAGATGTGATATTTCCACAATGG + Intergenic
1111015286 13:82372228-82372250 AAACTGTGCTCTTACCACCTTGG + Intergenic
1113541102 13:111110399-111110421 AATTTGTCCTCTTCCCAAAAGGG + Intergenic
1113893638 13:113749419-113749441 CAGCTGTGCTGACCCCACAATGG + Intergenic
1114645386 14:24253131-24253153 AAACTCTGCTCTTCCCACTGTGG - Intronic
1114677482 14:24453485-24453507 CAGCTGTGCCCTTCCCCCAGAGG + Intergenic
1114813666 14:25929858-25929880 AAGCTGTGCATTTCCCTCAGGGG + Intergenic
1116289745 14:43018251-43018273 AAACTGTGCTCTTACCACCTTGG - Intergenic
1116792766 14:49357125-49357147 CAGCTATGCCCTTCCCACAGAGG - Intergenic
1118103142 14:62628173-62628195 AAATTGTCCTCTTCTCACAACGG - Intergenic
1118559849 14:67067538-67067560 CAGCTATGCCCTGCCCACAAAGG + Intronic
1119948415 14:78719139-78719161 AATCTATGCTCTTCCCTGAATGG + Intronic
1120081866 14:80226500-80226522 AACCTGTGCCCTTCCCATGATGG + Intronic
1120804283 14:88729335-88729357 ATTCTATGCTCTTACCACAAGGG + Intronic
1121437512 14:93929005-93929027 AGGCTGGGCTCTTCCTCCAAAGG - Exonic
1126708309 15:51428363-51428385 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1126708430 15:51429370-51429392 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1127385396 15:58462714-58462736 GGGCTGTGCTCCTCCCACACAGG - Intronic
1128461738 15:67873970-67873992 ATGCTGTGCTCTCCCCAGCAGGG + Intergenic
1129479573 15:75812287-75812309 AAGCTGTTCTATTCCAACAAGGG - Intergenic
1131297168 15:91159358-91159380 AAGCTCTGCTCTACCCAAAAGGG + Intronic
1131450578 15:92536104-92536126 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1132168839 15:99626522-99626544 ATGCTGTGATTTTCCCCCAAAGG - Intronic
1133841159 16:9410949-9410971 AAGCTGTGCCCTGCCCACCTTGG - Intergenic
1135654248 16:24233872-24233894 AAGATGTGTTCTTTCCAGAAGGG - Intergenic
1136776491 16:32874484-32874506 CAGCTGTGCTCTGAGCACAAGGG - Intergenic
1136894124 16:33987028-33987050 CAGCTGTGCTCTGAGCACAAGGG + Intergenic
1137416744 16:48289265-48289287 AAGCTGTGCTCTGACCACCTTGG - Intronic
1138898071 16:61233654-61233676 AAAATGTGCTCTTTCCTCAAAGG + Intergenic
1140140495 16:72252074-72252096 AAGCTGTGCTCTTTCCTCAATGG - Intergenic
1140298921 16:73737438-73737460 ATGCTGTCTTCATCCCACAAAGG - Intergenic
1142250762 16:88990807-88990829 AAGCTCTGCTCTTCCTTCCATGG - Intergenic
1203078906 16_KI270728v1_random:1136593-1136615 CAGCTGTGCTCTGAGCACAAGGG - Intergenic
1143336109 17:6172786-6172808 AAGCTGTGGATTACCCACAAAGG + Intergenic
1144809727 17:17991041-17991063 AATATGTGCTCTTGCCATAAGGG + Intronic
1147513629 17:41095632-41095654 AAGCTGTGCTCTGACCACTTTGG + Intronic
1147515732 17:41115921-41115943 AAGCTGTGCTCTGACCACTTTGG + Intergenic
1149428720 17:56579421-56579443 AAGTTCTGCTCCTCCCTCAATGG + Intergenic
1150726094 17:67652679-67652701 AAGCGATGCTCTTGCCTCAAGGG - Intronic
1151136415 17:71950068-71950090 AAACTGTGCTCTGACCACATTGG + Intergenic
1152580078 17:81161977-81161999 AGGCTGTGCGCTTCCCTCCATGG - Intronic
1153600359 18:6775039-6775061 AATGTGTGCTCTTCCCAGAAAGG + Intronic
1153891921 18:9524924-9524946 AAACTATGCTCTTTCCACCATGG - Intronic
1155316554 18:24577636-24577658 AAGCCTTTCTCTTCCCACTAAGG - Intergenic
1158310282 18:56150928-56150950 AAGCTGTGCTCTAACCAGGAAGG + Intergenic
1158931993 18:62331677-62331699 GACCTGTGGTCTTCCCACACTGG + Intronic
1160060847 18:75527511-75527533 ATGCCCTGCTCTTCCCACAGTGG + Intergenic
1160198387 18:76776460-76776482 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1160462920 18:79052975-79052997 ATGCTGGGTTCTTCCCCCAAAGG + Intergenic
1161468438 19:4444795-4444817 AGGCTGTGCTGTGCCCACAAAGG - Intronic
1164256360 19:23531706-23531728 TACCTGTGCTCTTCCTACAGGGG - Intronic
1164556252 19:29255092-29255114 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1165534237 19:36429883-36429905 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1166826730 19:45614493-45614515 AAGCAGTGAGCTTCCCACACTGG + Intronic
1167805471 19:51780717-51780739 AGGCTCTGCTTCTCCCACAAGGG - Intronic
925989760 2:9245185-9245207 GAGCTGGGCTCCTCCCACACAGG + Intronic
927746257 2:25624282-25624304 AAGCTGTGCTCTGACCACCTTGG + Intronic
930172072 2:48262304-48262326 AAGCTGTGCCCTGCCCACCTTGG + Intergenic
930182615 2:48378607-48378629 ATGCTGTGATCTTCACAAAAGGG - Exonic
930536474 2:52651234-52651256 AAGCTCTGCCCTTTCCACGATGG + Intergenic
930776711 2:55179706-55179728 GAGCTCTGCTCTTCCAACTAGGG + Intronic
931381971 2:61762083-61762105 AATCTGTGCTCTTCCCAGGATGG - Intergenic
933533761 2:83545397-83545419 CAGCTGTGCTCAGCCCACATTGG - Intergenic
933809805 2:86026195-86026217 AGGCTGAGCTCTTCCCCCTAAGG + Exonic
935053661 2:99546015-99546037 AAACTGTGCTCTTCTGAGAATGG + Intronic
935225389 2:101047873-101047895 AACCAGTTCTCTTACCACAAGGG + Intronic
935370840 2:102345194-102345216 ATGAAGTGCTCTTCCCACAGAGG + Intronic
936058038 2:109276070-109276092 AGGCAGTGCTCTTCCCAGGAAGG + Intronic
936114345 2:109690192-109690214 AAGCTGTGCTCTGACCACCTTGG - Intergenic
936259452 2:110946627-110946649 AAACTGTGCTCATCCCATTAAGG - Intronic
936478492 2:112863403-112863425 AAGCTGTGCTCTTACCACCTTGG + Intergenic
937047942 2:118862207-118862229 AAGCTATGCTCTTCTCAAATGGG - Intergenic
937158622 2:119739786-119739808 CACCTGTCCTCTTCCCTCAAGGG + Intergenic
940398248 2:153218542-153218564 TATCTGTGCTCTTCCCACAGTGG + Intergenic
940812863 2:158265446-158265468 AAGCTTTAATCTTCACACAAGGG + Intronic
940891591 2:159041368-159041390 CAGCTGTGCCCTTCCCCCAGAGG + Intronic
940892414 2:159047727-159047749 AAGCTGTGCTCTGACCACTTTGG + Intronic
941230739 2:162908816-162908838 TTGCTGTTCTCTTCCTACAATGG - Intergenic
944374796 2:199028996-199029018 CAGCTGTGCCCTGCCCACAGAGG - Intergenic
945899958 2:215526383-215526405 AAGTTGTTCTCTCCCCACCATGG + Intergenic
946172499 2:217903915-217903937 AAGCAGGGCTCTTCCCACAGAGG - Intronic
946696826 2:222368341-222368363 CAGCTATGCTCTGCCCACAGAGG + Intergenic
946781550 2:223196781-223196803 AAGCTGTTCTCTTACTAGAAAGG + Intronic
947129453 2:226905978-226906000 AACCTCTGCTGTTACCACAAAGG - Intronic
947983552 2:234429571-234429593 TAGCTGTGCTCTTGCCTCCAAGG + Intergenic
948772828 2:240260273-240260295 CAGCTGAGCTCTCCCCACCAAGG + Intergenic
1169547819 20:6668740-6668762 AAGCTGTGGTCATTCAACAATGG + Intergenic
1170626845 20:18036686-18036708 AAGATGTCCTCTGCCCACAGAGG - Intronic
1172901780 20:38340477-38340499 AGGCTGTGCTTATCCCAGAAGGG - Intergenic
1173192669 20:40887993-40888015 AGGCTCTGCTCATCCCATAAAGG + Intergenic
1173897369 20:46561291-46561313 AAGCTGTGCTCCACCCACCTTGG + Intronic
1175327110 20:58137560-58137582 AATCTGTGCTCCTGCCACACTGG - Intergenic
1175471223 20:59230249-59230271 TAGCTGTTTTCTCCCCACAATGG - Intronic
1175553969 20:59834649-59834671 ACGCTATGGTCTTCCCACACTGG + Intronic
1177197960 21:17922868-17922890 AAGCTGTGCTCTGACCACCTTGG - Intronic
1177644408 21:23883887-23883909 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1177990239 21:28028212-28028234 AACCTCTGCTCTTCCCATGAGGG - Intergenic
1179400827 21:41081469-41081491 AAGCTGTGCTCTGACCACCGTGG - Intergenic
1182057798 22:27373582-27373604 CAGCTGTGCCCTGCCCACAGAGG - Intergenic
1182675860 22:32039314-32039336 ACTCTGTGATGTTCCCACAAGGG + Intergenic
1184477741 22:44730494-44730516 CAGCTGTCCCCGTCCCACAAGGG + Intronic
1185219994 22:49624408-49624430 TCACTGTGCTCTCCCCACAAAGG - Exonic
1185390076 22:50555149-50555171 AAGCTGTGCTCTGACCACCTTGG + Intronic
949328942 3:2899951-2899973 AAGCTAAGCTATTCTCACAAAGG + Intronic
949440792 3:4078055-4078077 AAGCTGCGCTCTTGCCAACAGGG - Intronic
949804030 3:7934719-7934741 CAGCTATGCTCTGCCCACAGAGG - Intergenic
950242268 3:11381736-11381758 CAGCTGTGCTATTCCCATAGCGG + Intronic
950443942 3:13025403-13025425 GAGCTGTGCCCTGCCCTCAAAGG - Intronic
951906430 3:27712400-27712422 AAGCCCTGCTGTCCCCACAAGGG + Intergenic
952176267 3:30866647-30866669 AAGCTCTGCTCTTCTCACAGGGG - Intronic
952962643 3:38602358-38602380 AAGCTGTGGTCTGCCCCCAGGGG + Intronic
952974221 3:38680503-38680525 CAGAGGTGCTCTTCCCACCATGG + Intergenic
953243155 3:41167422-41167444 AATCTCTTCCCTTCCCACAAAGG + Intergenic
953787567 3:45922454-45922476 AAGCTCTGCTCTTCCCCCAGCGG - Intronic
954491900 3:50914818-50914840 AATTTTTGCTTTTCCCACAATGG + Intronic
955136427 3:56223278-56223300 AAGCTTTGCTCTTCCAGCAAAGG - Intronic
959160596 3:102719845-102719867 AAGCTGTCCTCTTCCCTTATAGG - Intergenic
960058885 3:113298316-113298338 GAGCTGTGCTCTCCCTAGAATGG + Intronic
960227637 3:115185579-115185601 AAGCTGTGCCCTGACCACATTGG + Intergenic
963531557 3:146477643-146477665 CAGCTATGCCCTGCCCACAAAGG - Intronic
965309272 3:167108846-167108868 AAGCAGTTTTCTTCCAACAAAGG + Intergenic
965716567 3:171611215-171611237 AAACTGTGGACTTCCTACAAAGG + Intronic
966457681 3:180136141-180136163 AAGCTGTGCTCTGACCACCTTGG + Intergenic
967939601 3:194755982-194756004 GTGCTGGGCTCTTCCCAGAAGGG + Intergenic
968294781 3:197567586-197567608 AAGCTGTGCTCTGACCACCTTGG + Intronic
968383041 4:111351-111373 AAGCTGTGCTCTGACCACCTTGG + Intergenic
969307926 4:6336288-6336310 GAGCTTTCCTCTTTCCACAAGGG + Intronic
969368342 4:6713771-6713793 AAGCTGTGCTCTGACCACCTTGG - Intergenic
969445059 4:7240005-7240027 AAGCTCTGCTCTCCACAGAAGGG + Intronic
969934997 4:10671498-10671520 CAGCTGTGCTCTACTCAGAATGG + Intronic
970523532 4:16909138-16909160 AAACTGTGCTTGTCCCAGAATGG + Intergenic
970618782 4:17795710-17795732 AAGCTGTGATATTCTCAGAAAGG - Intergenic
970854629 4:20637733-20637755 AAGCTGTGCTCTGACCACCTTGG - Intergenic
970955912 4:21810902-21810924 AAGCTGTGCTCATTGCAAAATGG + Intronic
971104627 4:23509940-23509962 AAGGTGTTTTCTTACCACAATGG - Intergenic
971875768 4:32306422-32306444 AAGCTGTGCTCTCACCACCTTGG - Intergenic
972196207 4:36656558-36656580 TAGCTGTGCCCTGCCCACAGAGG - Intergenic
972912007 4:43829003-43829025 AAGCTGTGCTCTGACCACCTTGG + Intergenic
974687993 4:65256278-65256300 ATGCTGTGGTCTTCACACAGTGG - Intergenic
975286566 4:72628393-72628415 AAGATTTGCTTTTCCCACAAAGG - Intergenic
975364936 4:73518420-73518442 CAGCTATGCTCTGCCCACAGAGG + Intergenic
977041577 4:92025455-92025477 AAGCTGTGCTCTCACCACCTTGG - Intergenic
977042984 4:92037559-92037581 AAGCTGTGCTCTGACCACCTTGG - Intergenic
978606687 4:110488101-110488123 CAGCTGTTCACTTCCCATAAGGG + Intronic
982920313 4:161266464-161266486 AAGCTGTGCTCTGACCACCTTGG - Intergenic
983405300 4:167321915-167321937 AAGCTGTCATTTTCCCACTAGGG + Intergenic
984712425 4:182896768-182896790 AGGCTGGGCTCTGCCCTCAAGGG - Intronic
985509040 5:301627-301649 AAGCTGTGCTCTCCCCACAAAGG - Intronic
985509057 5:301722-301744 AAGCTGTGCTCTCCCCACAAAGG - Intronic
985509073 5:301817-301839 AAGCTGTGCTCTTCCCACAAAGG - Intronic
985509086 5:301912-301934 AAGCTGTGCTCTTCCCACAAAGG - Intronic
985509101 5:302007-302029 AAGCTGTGCTCTTCCCACAAAGG - Intronic
985509115 5:302130-302152 AAGCTGTGCTATTCCCACAAAGG - Intronic
985509130 5:302237-302259 AAGCTGTGCTCTTACCACAAAGG - Intronic
985509148 5:302332-302354 AAGCTGTGCCCTTCCCACAAAGG - Intronic
985509164 5:302427-302449 AAGCTGTGCTCTCCCCACAAAGG - Intronic
985509181 5:302539-302561 AAGCTGTGCTCTCCCCACTAAGG - Intronic
985509196 5:302634-302656 AAGCTGTGCTCTTCCCACAAAGG - Intronic
985509215 5:302729-302751 AAGCTGTGCTCTCCCCACAAAGG - Intronic
985509232 5:302821-302843 AAGCTGTGCTCTCCCCACAAAGG - Intronic
985509245 5:302916-302938 AAGCTGTGCTCTTCCCACAAAGG - Intronic
985739026 5:1603976-1603998 AAGCTGTGCTCTTCCCACAAAGG + Intergenic
985739064 5:1604187-1604209 AAGCTGTGCTCTCCCCACAAAGG + Intergenic
985739079 5:1604286-1604308 AAGCTGTGCTCTTCCCACAAAGG + Intergenic
985750193 5:1669196-1669218 AAGCTGTGCTCTGACCACCTTGG + Intergenic
986922161 5:12698906-12698928 CAGCTGTGCTCTTCCCACTGTGG - Intergenic
987279707 5:16400547-16400569 CAGCTGTGCCCTGCCCACAGAGG + Intergenic
987857278 5:23437223-23437245 AATCTGTGCTCTGCACTCAAGGG + Intergenic
988975219 5:36508579-36508601 CAGCTATGCTCTGCCCACAGAGG - Intergenic
991216032 5:64158199-64158221 AAGGTGTGCACTACCCACAAAGG - Intergenic
991970298 5:72134551-72134573 AAGCTGTTGTCTTACCACATAGG + Intronic
994155991 5:96504968-96504990 AAAATGTGATCTACCCACAATGG - Intergenic
995550457 5:113276103-113276125 CTGCTGTGCTGTTCCCACACTGG - Intronic
996029065 5:118684853-118684875 AAGATGTCCTCTTCCGACAAAGG + Intergenic
997187649 5:131898510-131898532 CAGCTATGCCCTGCCCACAAAGG + Intronic
999846696 5:155489534-155489556 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1000083408 5:157868312-157868334 AGGCTGTCCTCTTCACAAAAAGG + Intergenic
1000175002 5:158743355-158743377 AAGCTGTACTCTGCCCAAACTGG - Intronic
1000350287 5:160347425-160347447 AAGCTGACCCCTTCCCACAGGGG + Intergenic
1002396983 5:178965327-178965349 AAGGTGTGCCCTGCACACAAAGG - Exonic
1003496596 6:6668694-6668716 CAGCTATGCCCTGCCCACAAAGG - Intergenic
1003831263 6:10014665-10014687 CAGCTGTGTCCTTTCCACAAGGG + Intronic
1003848190 6:10195880-10195902 AAGGTGTTCTTTTCCCATAATGG + Intronic
1004087053 6:12459992-12460014 TAACTGTGCTCTTCCCAACACGG + Intergenic
1004156660 6:13175060-13175082 AATCTGTGCTCTACACAAAAAGG - Intronic
1005322574 6:24669201-24669223 AAGCTGTGCTCTGACCACCTTGG - Intronic
1006961556 6:37936121-37936143 AAGCAGTGCTTTTCACAGAATGG + Intronic
1009631218 6:66203101-66203123 GATCTGTGCTCATCCCACAGCGG - Intergenic
1009935181 6:70225344-70225366 AATCTGGGCCCTTCACACAAGGG + Intronic
1010667146 6:78644053-78644075 CAGCTATGCTCTGCCCACAGAGG + Intergenic
1011079272 6:83471875-83471897 AACCTGTGCTAGTCACACAAAGG + Intergenic
1013578283 6:111507308-111507330 TAGCTATGCCCTGCCCACAAAGG + Intergenic
1015236176 6:130973830-130973852 AAACTGTGCTCTGACCACCATGG + Intronic
1015238336 6:130995533-130995555 AAACTGTGCTCTGACCACCACGG + Intronic
1019925934 7:4191788-4191810 AAGCTGGGCTATCCCCACAGAGG + Intronic
1024655111 7:51445865-51445887 AAACTGTGTTGTTCACACAAAGG - Intergenic
1024924746 7:54600939-54600961 GAACTGTGTCCTTCCCACAATGG + Intergenic
1024946898 7:54817474-54817496 AAGCTGTGCCCTTACCACCATGG + Intergenic
1025624583 7:63208794-63208816 CAGCTGTTCACTTCCCATAAGGG + Intergenic
1027733431 7:81903839-81903861 AAGCTGTGCCCCTACCACACAGG - Intergenic
1029259169 7:99290030-99290052 AAGCTGTGCTCTAATCACACAGG + Intergenic
1030005884 7:105119243-105119265 AATCAGTGCTCTGCTCACAAAGG + Intronic
1030168941 7:106582337-106582359 AAACTGTGCTCTGACCACAATGG + Intergenic
1030942645 7:115673339-115673361 AAACTGTGCTTTTTCTACAAAGG + Intergenic
1031924759 7:127628803-127628825 CAGCTTTGCTGTGCCCACAAAGG + Intergenic
1032402125 7:131630768-131630790 GAGCTGAGCTGTTCCTACAAAGG - Intergenic
1033523009 7:142181619-142181641 AGGCTGTGCTCTTCCCTCTTAGG + Intronic
1034670315 7:152852763-152852785 AAACTGTGCTCTTCCAACAGTGG - Intronic
1034689853 7:153005689-153005711 AAGCTGTGCCCTGCCCACCCTGG + Intergenic
1036403108 8:8428099-8428121 AATCTCTCCTCCTCCCACAAAGG - Intergenic
1037647273 8:20803877-20803899 AAGCTGTGCTCTGACCACACTGG + Intergenic
1038094614 8:24293970-24293992 AAGCTGTGGTCCTGCAACAATGG - Intergenic
1039244750 8:35596568-35596590 AAACTGTGCTCTGACCACATTGG - Intronic
1039676743 8:39676233-39676255 CAGCTATGCTCTGCCCACAGAGG + Intronic
1040106969 8:43546827-43546849 AAGCTGGGGTCCTCCCCCAAAGG - Intergenic
1040278347 8:46025237-46025259 GTGCTGTCCTCTTCCCACAGGGG + Intergenic
1040944406 8:52868594-52868616 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1041374851 8:57203227-57203249 AATCTTTGCTCTTCCCAGAGGGG + Intergenic
1041668920 8:60473416-60473438 AAGCTTTGTCCTTGCCACAAGGG + Intergenic
1044264999 8:90171549-90171571 ATCCTGTGCTCTTGACACAAAGG - Intergenic
1045545006 8:103120713-103120735 AATTTGTGCTCTGCCAACAAAGG - Intergenic
1046115210 8:109776544-109776566 CAGCTGTGCCCTGCCCACAGAGG + Intergenic
1046221920 8:111227802-111227824 AAGCTGTACTCTGACCACATTGG + Intergenic
1046222606 8:111235582-111235604 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1046495415 8:115007891-115007913 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1046720655 8:117615212-117615234 AAATTGTGCTTTGCCCACAAAGG - Intergenic
1046879199 8:119289906-119289928 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1046880939 8:119307317-119307339 CAGCTGTGCCCTACCCACAGAGG - Intergenic
1048797518 8:138164762-138164784 AAGCTGTGCTCTGACCACCTTGG + Intronic
1050989964 9:12137977-12137999 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1054890026 9:70240837-70240859 CAGCTATGCCCTGCCCACAAAGG - Intergenic
1055896527 9:81182872-81182894 AAGCTCTGCTATGCCCACAGAGG + Intergenic
1056271444 9:84951788-84951810 AGGCTGTCCTCTTTCCGCAAGGG + Intronic
1056303195 9:85263145-85263167 AAGTCATGCTCTTCCCACTATGG - Intergenic
1057690179 9:97276952-97276974 AAACTGTGCTCTGACCACATTGG - Intergenic
1058111590 9:101036184-101036206 CAGCCCTGCTCTTTCCACAAAGG + Intronic
1058327387 9:103715626-103715648 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1058676835 9:107407256-107407278 ATCCAGTGCTCTTCCCACTATGG - Intergenic
1058732871 9:107867432-107867454 AAGCTCTCCTCCTCCCTCAAAGG - Intergenic
1058997485 9:110314310-110314332 AAGCTGTGCTCTCACCACCTGGG + Intronic
1060935485 9:127512638-127512660 AAGCTGTGCTCTGACCACCTGGG + Intronic
1061372092 9:130203018-130203040 AAGCTGAGCTCTTGCCTCCAGGG + Intronic
1061442237 9:130613428-130613450 CAGCTATCCTCTTCCCACAAAGG - Intronic
1062325499 9:136010723-136010745 CAGCTGTGCACGTCCCACAGTGG + Exonic
1186156219 X:6729422-6729444 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1186763278 X:12745477-12745499 AAACTGTGCTCTTACCACCTTGG + Intergenic
1187161465 X:16769046-16769068 AAGCTGTGCTCTGACCACGTTGG - Intergenic
1187385627 X:18845975-18845997 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1187429807 X:19211702-19211724 AAGCTGCTCTCTTCCCTCTAGGG + Intergenic
1188081513 X:25847405-25847427 AATATGTGCTCTGCCTACAATGG - Intergenic
1188285489 X:28321806-28321828 AAGCTGTGCTCTGACCACCTTGG - Intergenic
1188954544 X:36418452-36418474 CAGCTATGCCCTGCCCACAAAGG + Intergenic
1190956642 X:55201495-55201517 AAGCTGTGCCCTGCCCACCTTGG + Intronic
1190970684 X:55344210-55344232 CAGCTATGCCCTTCCCACATAGG - Intergenic
1191252620 X:58266736-58266758 AGGCTGTGTTCCTCCCACAAAGG - Intergenic
1191629882 X:63311555-63311577 AACCTCTGCCCTTTCCACAATGG + Intergenic
1192353514 X:70377961-70377983 AATCTGTTCTCTAACCACAATGG + Intronic
1193053637 X:77126797-77126819 AACCTCTGCTCTTTCCATAATGG - Intergenic
1193266144 X:79472150-79472172 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1195195837 X:102497376-102497398 AAGCTGTGCTCTAACCACCTTGG + Intergenic
1195220645 X:102742876-102742898 AAGCTGTGCCCCGACCACAATGG - Intronic
1195225506 X:102788511-102788533 AAGCTGTGCTCTGACCACCCTGG - Intergenic
1195487032 X:105421072-105421094 AAACTGTGCTCTGACCACCATGG - Intronic
1195534061 X:105990723-105990745 AAGCTGTGCTCTGACCACCTTGG + Intergenic
1195947441 X:110230062-110230084 CAGCTGTGCCCTGCCCACAGAGG - Intronic
1195995185 X:110724661-110724683 AATTTGTGCTCTTCACAGAATGG + Intronic
1196230165 X:113212118-113212140 CAGCTATGCTCTGCCCCCAAAGG + Intergenic
1196385212 X:115141309-115141331 AAGCTGTGCTCTGACCACCTTGG - Intronic
1200159211 X:153996440-153996462 AAGCTGTGCTCTGACCACCTCGG + Intergenic
1200545084 Y:4509829-4509851 AAGCTGTGCTCTGACCACCTGGG + Intergenic
1201429078 Y:13887482-13887504 AAGGAATGCTCTTCTCACAAAGG + Intergenic
1201601071 Y:15728933-15728955 AAGCTGTGCTCCAACCACCATGG + Intergenic
1202068299 Y:20963095-20963117 TTGCTGAGCTCTGCCCACAAAGG - Intergenic