ID: 985739863

View in Genome Browser
Species Human (GRCh38)
Location 5:1608947-1608969
Sequence GAGGATGCTCCCTTCGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985739863_985739866 -10 Left 985739863 5:1608947-1608969 CCACCCTCGAAGGGAGCATCCTC No data
Right 985739866 5:1608960-1608982 GAGCATCCTCCTCACCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985739863 Original CRISPR GAGGATGCTCCCTTCGAGGG TGG (reversed) Intergenic
No off target data available for this crispr