ID: 985740368

View in Genome Browser
Species Human (GRCh38)
Location 5:1612331-1612353
Sequence GGATTTAAACAGAGGAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985740368_985740373 6 Left 985740368 5:1612331-1612353 CCATGGTTCCTCTGTTTAAATCC No data
Right 985740373 5:1612360-1612382 AATCCCACCCAACTCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985740368 Original CRISPR GGATTTAAACAGAGGAACCA TGG (reversed) Intergenic
No off target data available for this crispr