ID: 985740373

View in Genome Browser
Species Human (GRCh38)
Location 5:1612360-1612382
Sequence AATCCCACCCAACTCAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985740367_985740373 7 Left 985740367 5:1612330-1612352 CCCATGGTTCCTCTGTTTAAATC No data
Right 985740373 5:1612360-1612382 AATCCCACCCAACTCAGAGAAGG No data
985740368_985740373 6 Left 985740368 5:1612331-1612353 CCATGGTTCCTCTGTTTAAATCC No data
Right 985740373 5:1612360-1612382 AATCCCACCCAACTCAGAGAAGG No data
985740369_985740373 -2 Left 985740369 5:1612339-1612361 CCTCTGTTTAAATCCCCTGCTAA No data
Right 985740373 5:1612360-1612382 AATCCCACCCAACTCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985740373 Original CRISPR AATCCCACCCAACTCAGAGA AGG Intergenic
No off target data available for this crispr