ID: 985743479

View in Genome Browser
Species Human (GRCh38)
Location 5:1633695-1633717
Sequence GGGGGAGGCCGCGGGGCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985743470_985743479 0 Left 985743470 5:1633672-1633694 CCGCTGGGGACACGGCAGGTGAC No data
Right 985743479 5:1633695-1633717 GGGGGAGGCCGCGGGGCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985743479 Original CRISPR GGGGGAGGCCGCGGGGCAAC CGG Intergenic
No off target data available for this crispr