ID: 985745143

View in Genome Browser
Species Human (GRCh38)
Location 5:1642620-1642642
Sequence GCTGCTGCTCCCACACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985745139_985745143 -5 Left 985745139 5:1642602-1642624 CCTGGGCCAGCCTGGCCTGCTGC No data
Right 985745143 5:1642620-1642642 GCTGCTGCTCCCACACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985745143 Original CRISPR GCTGCTGCTCCCACACCTCC AGG Intergenic
No off target data available for this crispr