ID: 985746893

View in Genome Browser
Species Human (GRCh38)
Location 5:1652903-1652925
Sequence CTGGGGGGACACGAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985746881_985746893 -1 Left 985746881 5:1652881-1652903 CCCCCACCAGCCTGGTGACTTGC No data
Right 985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG No data
985746880_985746893 6 Left 985746880 5:1652874-1652896 CCTTGGGCCCCCACCAGCCTGGT No data
Right 985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG No data
985746882_985746893 -2 Left 985746882 5:1652882-1652904 CCCCACCAGCCTGGTGACTTGCT No data
Right 985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG No data
985746883_985746893 -3 Left 985746883 5:1652883-1652905 CCCACCAGCCTGGTGACTTGCTG No data
Right 985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG No data
985746878_985746893 13 Left 985746878 5:1652867-1652889 CCTGCTTCCTTGGGCCCCCACCA No data
Right 985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG No data
985746888_985746893 -7 Left 985746888 5:1652887-1652909 CCAGCCTGGTGACTTGCTGGGGG No data
Right 985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG No data
985746884_985746893 -4 Left 985746884 5:1652884-1652906 CCACCAGCCTGGTGACTTGCTGG No data
Right 985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985746893 Original CRISPR CTGGGGGGACACGAGGAAGA TGG Intergenic
No off target data available for this crispr