ID: 985747148

View in Genome Browser
Species Human (GRCh38)
Location 5:1654009-1654031
Sequence AGGAGCCGCTGTGCGCGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985747148_985747160 17 Left 985747148 5:1654009-1654031 CCTGAACGCGCACAGCGGCTCCT No data
Right 985747160 5:1654049-1654071 CCGCGCCCGCGTCCTCGGGCCGG No data
985747148_985747155 12 Left 985747148 5:1654009-1654031 CCTGAACGCGCACAGCGGCTCCT No data
Right 985747155 5:1654044-1654066 CCGCCCCGCGCCCGCGTCCTCGG No data
985747148_985747156 13 Left 985747148 5:1654009-1654031 CCTGAACGCGCACAGCGGCTCCT No data
Right 985747156 5:1654045-1654067 CGCCCCGCGCCCGCGTCCTCGGG No data
985747148_985747164 30 Left 985747148 5:1654009-1654031 CCTGAACGCGCACAGCGGCTCCT No data
Right 985747164 5:1654062-1654084 CTCGGGCCGGCAGCGCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985747148 Original CRISPR AGGAGCCGCTGTGCGCGTTC AGG (reversed) Intergenic
No off target data available for this crispr