ID: 985748117

View in Genome Browser
Species Human (GRCh38)
Location 5:1659290-1659312
Sequence CTGAGTCAGCACAGCCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985748117_985748120 2 Left 985748117 5:1659290-1659312 CCAAGCAGGCTGTGCTGACTCAG No data
Right 985748120 5:1659315-1659337 ATTCAAAGGAAAAATCCAACGGG No data
985748117_985748119 1 Left 985748117 5:1659290-1659312 CCAAGCAGGCTGTGCTGACTCAG No data
Right 985748119 5:1659314-1659336 CATTCAAAGGAAAAATCCAACGG No data
985748117_985748121 6 Left 985748117 5:1659290-1659312 CCAAGCAGGCTGTGCTGACTCAG No data
Right 985748121 5:1659319-1659341 AAAGGAAAAATCCAACGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985748117 Original CRISPR CTGAGTCAGCACAGCCTGCT TGG (reversed) Intergenic
No off target data available for this crispr