ID: 985751600

View in Genome Browser
Species Human (GRCh38)
Location 5:1681813-1681835
Sequence TTGGGTCCCTGGGAGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985751594_985751600 22 Left 985751594 5:1681768-1681790 CCTGGTGGCAGCTGGGCTCTCAA No data
Right 985751600 5:1681813-1681835 TTGGGTCCCTGGGAGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985751600 Original CRISPR TTGGGTCCCTGGGAGTATGT GGG Intergenic
No off target data available for this crispr