ID: 985753093

View in Genome Browser
Species Human (GRCh38)
Location 5:1694068-1694090
Sequence CAGATCCTCCAGAAGGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985753093_985753098 30 Left 985753093 5:1694068-1694090 CCTCAGACCTTCTGGAGGATCTG No data
Right 985753098 5:1694121-1694143 TGAAGAGCTTTTAGCATTTCTGG No data
985753093_985753095 -1 Left 985753093 5:1694068-1694090 CCTCAGACCTTCTGGAGGATCTG No data
Right 985753095 5:1694090-1694112 GACTTCCATCTGATGTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985753093 Original CRISPR CAGATCCTCCAGAAGGTCTG AGG (reversed) Intergenic
No off target data available for this crispr