ID: 985753095

View in Genome Browser
Species Human (GRCh38)
Location 5:1694090-1694112
Sequence GACTTCCATCTGATGTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985753089_985753095 25 Left 985753089 5:1694042-1694064 CCCATGTATTTATTGAAACTGGT No data
Right 985753095 5:1694090-1694112 GACTTCCATCTGATGTCATTTGG No data
985753093_985753095 -1 Left 985753093 5:1694068-1694090 CCTCAGACCTTCTGGAGGATCTG No data
Right 985753095 5:1694090-1694112 GACTTCCATCTGATGTCATTTGG No data
985753090_985753095 24 Left 985753090 5:1694043-1694065 CCATGTATTTATTGAAACTGGTG No data
Right 985753095 5:1694090-1694112 GACTTCCATCTGATGTCATTTGG No data
985753094_985753095 -8 Left 985753094 5:1694075-1694097 CCTTCTGGAGGATCTGACTTCCA No data
Right 985753095 5:1694090-1694112 GACTTCCATCTGATGTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985753095 Original CRISPR GACTTCCATCTGATGTCATT TGG Intergenic
No off target data available for this crispr