ID: 985753098

View in Genome Browser
Species Human (GRCh38)
Location 5:1694121-1694143
Sequence TGAAGAGCTTTTAGCATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985753094_985753098 23 Left 985753094 5:1694075-1694097 CCTTCTGGAGGATCTGACTTCCA No data
Right 985753098 5:1694121-1694143 TGAAGAGCTTTTAGCATTTCTGG No data
985753096_985753098 3 Left 985753096 5:1694095-1694117 CCATCTGATGTCATTTGGCTTCA No data
Right 985753098 5:1694121-1694143 TGAAGAGCTTTTAGCATTTCTGG No data
985753093_985753098 30 Left 985753093 5:1694068-1694090 CCTCAGACCTTCTGGAGGATCTG No data
Right 985753098 5:1694121-1694143 TGAAGAGCTTTTAGCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985753098 Original CRISPR TGAAGAGCTTTTAGCATTTC TGG Intergenic
No off target data available for this crispr