ID: 985753417

View in Genome Browser
Species Human (GRCh38)
Location 5:1697339-1697361
Sequence AAACTCTGCTTCACAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985753415_985753417 20 Left 985753415 5:1697296-1697318 CCGGTGTACTCTGTAATCTCGTT No data
Right 985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985753417 Original CRISPR AAACTCTGCTTCACAAAGAC AGG Intergenic