ID: 985758391

View in Genome Browser
Species Human (GRCh38)
Location 5:1732660-1732682
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758391_985758405 24 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758405 5:1732707-1732729 GGGCAGTCACATGAGGGGCGGGG No data
985758391_985758404 23 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758404 5:1732706-1732728 AGGGCAGTCACATGAGGGGCGGG No data
985758391_985758396 3 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758396 5:1732686-1732708 GGAGAAGACAGATTTTACCCAGG No data
985758391_985758398 17 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758398 5:1732700-1732722 TTACCCAGGGCAGTCACATGAGG No data
985758391_985758399 18 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758399 5:1732701-1732723 TACCCAGGGCAGTCACATGAGGG No data
985758391_985758397 4 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758397 5:1732687-1732709 GAGAAGACAGATTTTACCCAGGG No data
985758391_985758403 22 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG No data
985758391_985758400 19 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758400 5:1732702-1732724 ACCCAGGGCAGTCACATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758391 Original CRISPR TGTCTGGCGCTGGTCTTCCT GGG (reversed) Intergenic