ID: 985758394

View in Genome Browser
Species Human (GRCh38)
Location 5:1732670-1732692
Sequence CTTCTCCACTTGTCTGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758394_985758405 14 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758405 5:1732707-1732729 GGGCAGTCACATGAGGGGCGGGG No data
985758394_985758396 -7 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758396 5:1732686-1732708 GGAGAAGACAGATTTTACCCAGG No data
985758394_985758400 9 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758400 5:1732702-1732724 ACCCAGGGCAGTCACATGAGGGG No data
985758394_985758407 30 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data
985758394_985758403 12 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG No data
985758394_985758404 13 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758404 5:1732706-1732728 AGGGCAGTCACATGAGGGGCGGG No data
985758394_985758397 -6 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758397 5:1732687-1732709 GAGAAGACAGATTTTACCCAGGG No data
985758394_985758398 7 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758398 5:1732700-1732722 TTACCCAGGGCAGTCACATGAGG No data
985758394_985758399 8 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758399 5:1732701-1732723 TACCCAGGGCAGTCACATGAGGG No data
985758394_985758406 24 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758406 5:1732717-1732739 ATGAGGGGCGGGGCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758394 Original CRISPR CTTCTCCACTTGTCTGGCGC TGG (reversed) Intergenic
No off target data available for this crispr