ID: 985758395

View in Genome Browser
Species Human (GRCh38)
Location 5:1732676-1732698
Sequence ATCTGTCTTCTCCACTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758395_985758398 1 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758398 5:1732700-1732722 TTACCCAGGGCAGTCACATGAGG No data
985758395_985758407 24 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data
985758395_985758406 18 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758406 5:1732717-1732739 ATGAGGGGCGGGGCCCACTGTGG No data
985758395_985758408 25 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758408 5:1732724-1732746 GCGGGGCCCACTGTGGAGCTGGG No data
985758395_985758404 7 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758404 5:1732706-1732728 AGGGCAGTCACATGAGGGGCGGG No data
985758395_985758403 6 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG No data
985758395_985758399 2 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758399 5:1732701-1732723 TACCCAGGGCAGTCACATGAGGG No data
985758395_985758405 8 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758405 5:1732707-1732729 GGGCAGTCACATGAGGGGCGGGG No data
985758395_985758400 3 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758400 5:1732702-1732724 ACCCAGGGCAGTCACATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758395 Original CRISPR ATCTGTCTTCTCCACTTGTC TGG (reversed) Intergenic
No off target data available for this crispr