ID: 985758401

View in Genome Browser
Species Human (GRCh38)
Location 5:1732703-1732725
Sequence GCCCCTCATGTGACTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758401_985758408 -2 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758408 5:1732724-1732746 GCGGGGCCCACTGTGGAGCTGGG No data
985758401_985758406 -9 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758406 5:1732717-1732739 ATGAGGGGCGGGGCCCACTGTGG No data
985758401_985758407 -3 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data
985758401_985758411 6 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758411 5:1732732-1732754 CACTGTGGAGCTGGGCTGTGTGG No data
985758401_985758413 19 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758413 5:1732745-1732767 GGCTGTGTGGCAAACATGGCAGG No data
985758401_985758412 15 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758412 5:1732741-1732763 GCTGGGCTGTGTGGCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758401 Original CRISPR GCCCCTCATGTGACTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr