ID: 985758402

View in Genome Browser
Species Human (GRCh38)
Location 5:1732704-1732726
Sequence CGCCCCTCATGTGACTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758402_985758406 -10 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758406 5:1732717-1732739 ATGAGGGGCGGGGCCCACTGTGG No data
985758402_985758411 5 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758411 5:1732732-1732754 CACTGTGGAGCTGGGCTGTGTGG No data
985758402_985758408 -3 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758408 5:1732724-1732746 GCGGGGCCCACTGTGGAGCTGGG No data
985758402_985758413 18 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758413 5:1732745-1732767 GGCTGTGTGGCAAACATGGCAGG No data
985758402_985758407 -4 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data
985758402_985758412 14 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758412 5:1732741-1732763 GCTGGGCTGTGTGGCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758402 Original CRISPR CGCCCCTCATGTGACTGCCC TGG (reversed) Intergenic
No off target data available for this crispr