ID: 985758403

View in Genome Browser
Species Human (GRCh38)
Location 5:1732705-1732727
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758394_985758403 12 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG No data
985758395_985758403 6 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG No data
985758391_985758403 22 Left 985758391 5:1732660-1732682 CCCAGGAAGACCAGCGCCAGACA No data
Right 985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG No data
985758392_985758403 21 Left 985758392 5:1732661-1732683 CCAGGAAGACCAGCGCCAGACAA No data
Right 985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr