ID: 985758407

View in Genome Browser
Species Human (GRCh38)
Location 5:1732723-1732745
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758401_985758407 -3 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data
985758394_985758407 30 Left 985758394 5:1732670-1732692 CCAGCGCCAGACAAGTGGAGAAG No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data
985758402_985758407 -4 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data
985758395_985758407 24 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type