ID: 985758408

View in Genome Browser
Species Human (GRCh38)
Location 5:1732724-1732746
Sequence GCGGGGCCCACTGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758401_985758408 -2 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758408 5:1732724-1732746 GCGGGGCCCACTGTGGAGCTGGG No data
985758395_985758408 25 Left 985758395 5:1732676-1732698 CCAGACAAGTGGAGAAGACAGAT No data
Right 985758408 5:1732724-1732746 GCGGGGCCCACTGTGGAGCTGGG No data
985758402_985758408 -3 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758408 5:1732724-1732746 GCGGGGCCCACTGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758408 Original CRISPR GCGGGGCCCACTGTGGAGCT GGG Intergenic
No off target data available for this crispr