ID: 985758411

View in Genome Browser
Species Human (GRCh38)
Location 5:1732732-1732754
Sequence CACTGTGGAGCTGGGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758402_985758411 5 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758411 5:1732732-1732754 CACTGTGGAGCTGGGCTGTGTGG No data
985758401_985758411 6 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758411 5:1732732-1732754 CACTGTGGAGCTGGGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758411 Original CRISPR CACTGTGGAGCTGGGCTGTG TGG Intergenic
No off target data available for this crispr