ID: 985758413

View in Genome Browser
Species Human (GRCh38)
Location 5:1732745-1732767
Sequence GGCTGTGTGGCAAACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985758410_985758413 -9 Left 985758410 5:1732731-1732753 CCACTGTGGAGCTGGGCTGTGTG No data
Right 985758413 5:1732745-1732767 GGCTGTGTGGCAAACATGGCAGG No data
985758401_985758413 19 Left 985758401 5:1732703-1732725 CCCAGGGCAGTCACATGAGGGGC No data
Right 985758413 5:1732745-1732767 GGCTGTGTGGCAAACATGGCAGG No data
985758402_985758413 18 Left 985758402 5:1732704-1732726 CCAGGGCAGTCACATGAGGGGCG No data
Right 985758413 5:1732745-1732767 GGCTGTGTGGCAAACATGGCAGG No data
985758409_985758413 -8 Left 985758409 5:1732730-1732752 CCCACTGTGGAGCTGGGCTGTGT No data
Right 985758413 5:1732745-1732767 GGCTGTGTGGCAAACATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985758413 Original CRISPR GGCTGTGTGGCAAACATGGC AGG Intergenic
No off target data available for this crispr