ID: 985760558

View in Genome Browser
Species Human (GRCh38)
Location 5:1746595-1746617
Sequence GGGGCCCGTTTCCCTGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985760547_985760558 19 Left 985760547 5:1746553-1746575 CCCTGTGAAGGCACCAAGCACGG No data
Right 985760558 5:1746595-1746617 GGGGCCCGTTTCCCTGTGGACGG No data
985760546_985760558 20 Left 985760546 5:1746552-1746574 CCCCTGTGAAGGCACCAAGCACG No data
Right 985760558 5:1746595-1746617 GGGGCCCGTTTCCCTGTGGACGG No data
985760550_985760558 6 Left 985760550 5:1746566-1746588 CCAAGCACGGCAGACGCCCTCAC No data
Right 985760558 5:1746595-1746617 GGGGCCCGTTTCCCTGTGGACGG No data
985760554_985760558 -10 Left 985760554 5:1746582-1746604 CCCTCACATCGCCGGGGCCCGTT No data
Right 985760558 5:1746595-1746617 GGGGCCCGTTTCCCTGTGGACGG No data
985760549_985760558 18 Left 985760549 5:1746554-1746576 CCTGTGAAGGCACCAAGCACGGC No data
Right 985760558 5:1746595-1746617 GGGGCCCGTTTCCCTGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985760558 Original CRISPR GGGGCCCGTTTCCCTGTGGA CGG Intergenic
No off target data available for this crispr