ID: 985761018

View in Genome Browser
Species Human (GRCh38)
Location 5:1748810-1748832
Sequence GTTCTCAGTGTCCCTCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985761018_985761021 18 Left 985761018 5:1748810-1748832 CCAGAATGAGGGACACTGAGAAC No data
Right 985761021 5:1748851-1748873 GCGAATTGGCACAGCCACCTTGG No data
985761018_985761020 4 Left 985761018 5:1748810-1748832 CCAGAATGAGGGACACTGAGAAC No data
Right 985761020 5:1748837-1748859 TCACACTTCTGCGTGCGAATTGG No data
985761018_985761022 28 Left 985761018 5:1748810-1748832 CCAGAATGAGGGACACTGAGAAC No data
Right 985761022 5:1748861-1748883 ACAGCCACCTTGGAAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985761018 Original CRISPR GTTCTCAGTGTCCCTCATTC TGG (reversed) Intergenic
No off target data available for this crispr