ID: 985764420

View in Genome Browser
Species Human (GRCh38)
Location 5:1769265-1769287
Sequence GGTCGTCGCCAGGGAGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985764420_985764428 8 Left 985764420 5:1769265-1769287 CCTGGCGCTCCCTGGCGACGACC No data
Right 985764428 5:1769296-1769318 ACTTCCAGGAGCGCCCCTGCGGG No data
985764420_985764424 -6 Left 985764420 5:1769265-1769287 CCTGGCGCTCCCTGGCGACGACC No data
Right 985764424 5:1769282-1769304 ACGACCCTGGTCAGACTTCCAGG No data
985764420_985764427 7 Left 985764420 5:1769265-1769287 CCTGGCGCTCCCTGGCGACGACC No data
Right 985764427 5:1769295-1769317 GACTTCCAGGAGCGCCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985764420 Original CRISPR GGTCGTCGCCAGGGAGCGCC AGG (reversed) Intergenic
No off target data available for this crispr