ID: 985764859

View in Genome Browser
Species Human (GRCh38)
Location 5:1771950-1771972
Sequence GATGCTGGGGCTCCACTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985764850_985764859 23 Left 985764850 5:1771904-1771926 CCAGGTCTTCCAAGTATGCACTA No data
Right 985764859 5:1771950-1771972 GATGCTGGGGCTCCACTGATTGG No data
985764851_985764859 14 Left 985764851 5:1771913-1771935 CCAAGTATGCACTAATGAGCTGT No data
Right 985764859 5:1771950-1771972 GATGCTGGGGCTCCACTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985764859 Original CRISPR GATGCTGGGGCTCCACTGAT TGG Intergenic
No off target data available for this crispr