ID: 985766907

View in Genome Browser
Species Human (GRCh38)
Location 5:1784890-1784912
Sequence GCCCCAGGACAAGCCCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985766893_985766907 25 Left 985766893 5:1784842-1784864 CCGTGGAGCAGCCTCCGGGTCTG No data
Right 985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG No data
985766901_985766907 1 Left 985766901 5:1784866-1784888 CCACTGAATGGTCCCGGGGCGAG No data
Right 985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG No data
985766897_985766907 11 Left 985766897 5:1784856-1784878 CCGGGTCTGGCCACTGAATGGTC No data
Right 985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG No data
985766890_985766907 30 Left 985766890 5:1784837-1784859 CCTCTCCGTGGAGCAGCCTCCGG No data
Right 985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG No data
985766895_985766907 14 Left 985766895 5:1784853-1784875 CCTCCGGGTCTGGCCACTGAATG No data
Right 985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985766907 Original CRISPR GCCCCAGGACAAGCCCACAG AGG Intergenic
No off target data available for this crispr