ID: 985767212

View in Genome Browser
Species Human (GRCh38)
Location 5:1786308-1786330
Sequence GACCCCAAGGGGGAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985767192_985767212 22 Left 985767192 5:1786263-1786285 CCTAGCCCCAGAAACATGCCGTC No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767190_985767212 28 Left 985767190 5:1786257-1786279 CCGCCACCTAGCCCCAGAAACAT No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767193_985767212 17 Left 985767193 5:1786268-1786290 CCCCAGAAACATGCCGTCCCAGG No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767205_985767212 -10 Left 985767205 5:1786295-1786317 CCTCATGGGAAGGGACCCCAAGG No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767195_985767212 16 Left 985767195 5:1786269-1786291 CCCAGAAACATGCCGTCCCAGGT No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767191_985767212 25 Left 985767191 5:1786260-1786282 CCACCTAGCCCCAGAAACATGCC No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767200_985767212 0 Left 985767200 5:1786285-1786307 CCCAGGTGACCCTCATGGGAAGG No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767204_985767212 -9 Left 985767204 5:1786294-1786316 CCCTCATGGGAAGGGACCCCAAG No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767202_985767212 -1 Left 985767202 5:1786286-1786308 CCAGGTGACCCTCATGGGAAGGG No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767196_985767212 15 Left 985767196 5:1786270-1786292 CCAGAAACATGCCGTCCCAGGTG No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data
985767198_985767212 4 Left 985767198 5:1786281-1786303 CCGTCCCAGGTGACCCTCATGGG No data
Right 985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985767212 Original CRISPR GACCCCAAGGGGGAGTTGGG TGG Intergenic
No off target data available for this crispr