ID: 985771140

View in Genome Browser
Species Human (GRCh38)
Location 5:1812143-1812165
Sequence CTGTGTCTGGTGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985771135_985771140 -10 Left 985771135 5:1812130-1812152 CCAAGGTTGAGGGCTGTGTCTGG 0: 1
1: 0
2: 2
3: 32
4: 271
Right 985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985771140 Original CRISPR CTGTGTCTGGTGAGGGTGGA AGG Intronic
No off target data available for this crispr