ID: 985773012

View in Genome Browser
Species Human (GRCh38)
Location 5:1824828-1824850
Sequence CTGAGGGTGGGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985772999_985773012 19 Left 985772999 5:1824786-1824808 CCAGACAGTGGCACTGAGTTGCC No data
Right 985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG No data
985773003_985773012 -2 Left 985773003 5:1824807-1824829 CCAAACATTGGATTCAAGGGCCT No data
Right 985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG No data
985772998_985773012 20 Left 985772998 5:1824785-1824807 CCCAGACAGTGGCACTGAGTTGC No data
Right 985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG No data
985772997_985773012 21 Left 985772997 5:1824784-1824806 CCCCAGACAGTGGCACTGAGTTG No data
Right 985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985773012 Original CRISPR CTGAGGGTGGGGAGGGAAGC AGG Intergenic
No off target data available for this crispr