ID: 985774196

View in Genome Browser
Species Human (GRCh38)
Location 5:1832144-1832166
Sequence TGGTGATGGTGAGCACACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985774196_985774203 -3 Left 985774196 5:1832144-1832166 CCTCTGTGTGCTCACCATCACCA No data
Right 985774203 5:1832164-1832186 CCAGCCGCAGGGATTCCGGGAGG No data
985774196_985774206 10 Left 985774196 5:1832144-1832166 CCTCTGTGTGCTCACCATCACCA No data
Right 985774206 5:1832177-1832199 TTCCGGGAGGAGGCATCCAAAGG No data
985774196_985774201 -6 Left 985774196 5:1832144-1832166 CCTCTGTGTGCTCACCATCACCA No data
Right 985774201 5:1832161-1832183 TCACCAGCCGCAGGGATTCCGGG No data
985774196_985774204 0 Left 985774196 5:1832144-1832166 CCTCTGTGTGCTCACCATCACCA No data
Right 985774204 5:1832167-1832189 GCCGCAGGGATTCCGGGAGGAGG No data
985774196_985774200 -7 Left 985774196 5:1832144-1832166 CCTCTGTGTGCTCACCATCACCA No data
Right 985774200 5:1832160-1832182 ATCACCAGCCGCAGGGATTCCGG No data
985774196_985774207 11 Left 985774196 5:1832144-1832166 CCTCTGTGTGCTCACCATCACCA No data
Right 985774207 5:1832178-1832200 TCCGGGAGGAGGCATCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985774196 Original CRISPR TGGTGATGGTGAGCACACAG AGG (reversed) Intergenic