ID: 985774199

View in Genome Browser
Species Human (GRCh38)
Location 5:1832158-1832180
Sequence GGAATCCCTGCGGCTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985774199_985774207 -3 Left 985774199 5:1832158-1832180 CCATCACCAGCCGCAGGGATTCC No data
Right 985774207 5:1832178-1832200 TCCGGGAGGAGGCATCCAAAGGG No data
985774199_985774206 -4 Left 985774199 5:1832158-1832180 CCATCACCAGCCGCAGGGATTCC No data
Right 985774206 5:1832177-1832199 TTCCGGGAGGAGGCATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985774199 Original CRISPR GGAATCCCTGCGGCTGGTGA TGG (reversed) Intergenic