ID: 985774202

View in Genome Browser
Species Human (GRCh38)
Location 5:1832164-1832186
Sequence CCTCCCGGAATCCCTGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985774202_985774207 -9 Left 985774202 5:1832164-1832186 CCAGCCGCAGGGATTCCGGGAGG No data
Right 985774207 5:1832178-1832200 TCCGGGAGGAGGCATCCAAAGGG No data
985774202_985774206 -10 Left 985774202 5:1832164-1832186 CCAGCCGCAGGGATTCCGGGAGG No data
Right 985774206 5:1832177-1832199 TTCCGGGAGGAGGCATCCAAAGG No data
985774202_985774211 30 Left 985774202 5:1832164-1832186 CCAGCCGCAGGGATTCCGGGAGG No data
Right 985774211 5:1832217-1832239 TTCCTTCCTTCTCACTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985774202 Original CRISPR CCTCCCGGAATCCCTGCGGC TGG (reversed) Intergenic
No off target data available for this crispr