ID: 985774206

View in Genome Browser
Species Human (GRCh38)
Location 5:1832177-1832199
Sequence TTCCGGGAGGAGGCATCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985774199_985774206 -4 Left 985774199 5:1832158-1832180 CCATCACCAGCCGCAGGGATTCC No data
Right 985774206 5:1832177-1832199 TTCCGGGAGGAGGCATCCAAAGG No data
985774196_985774206 10 Left 985774196 5:1832144-1832166 CCTCTGTGTGCTCACCATCACCA No data
Right 985774206 5:1832177-1832199 TTCCGGGAGGAGGCATCCAAAGG No data
985774202_985774206 -10 Left 985774202 5:1832164-1832186 CCAGCCGCAGGGATTCCGGGAGG No data
Right 985774206 5:1832177-1832199 TTCCGGGAGGAGGCATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985774206 Original CRISPR TTCCGGGAGGAGGCATCCAA AGG Intergenic