ID: 985775666

View in Genome Browser
Species Human (GRCh38)
Location 5:1840529-1840551
Sequence GACACACTCGTCCCAAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985775666_985775669 -9 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775669 5:1840543-1840565 GAGTGTGTCGGCACCTGCTCTGG No data
985775666_985775676 26 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775676 5:1840578-1840600 CCCAGAATTTACATCCACCTGGG No data
985775666_985775674 25 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775674 5:1840577-1840599 CCCCAGAATTTACATCCACCTGG No data
985775666_985775678 27 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775678 5:1840579-1840601 CCAGAATTTACATCCACCTGGGG No data
985775666_985775670 -8 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775670 5:1840544-1840566 AGTGTGTCGGCACCTGCTCTGGG No data
985775666_985775671 -5 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775671 5:1840547-1840569 GTGTCGGCACCTGCTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985775666 Original CRISPR GACACACTCGTCCCAAGGCC TGG (reversed) Intergenic
No off target data available for this crispr