ID: 985775669

View in Genome Browser
Species Human (GRCh38)
Location 5:1840543-1840565
Sequence GAGTGTGTCGGCACCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985775658_985775669 26 Left 985775658 5:1840494-1840516 CCTGAAGGTGGACTGAGCTGAGG No data
Right 985775669 5:1840543-1840565 GAGTGTGTCGGCACCTGCTCTGG No data
985775666_985775669 -9 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775669 5:1840543-1840565 GAGTGTGTCGGCACCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985775669 Original CRISPR GAGTGTGTCGGCACCTGCTC TGG Intergenic
No off target data available for this crispr