ID: 985775671

View in Genome Browser
Species Human (GRCh38)
Location 5:1840547-1840569
Sequence GTGTCGGCACCTGCTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985775658_985775671 30 Left 985775658 5:1840494-1840516 CCTGAAGGTGGACTGAGCTGAGG No data
Right 985775671 5:1840547-1840569 GTGTCGGCACCTGCTCTGGGTGG No data
985775668_985775671 -10 Left 985775668 5:1840534-1840556 CCTTGGGACGAGTGTGTCGGCAC No data
Right 985775671 5:1840547-1840569 GTGTCGGCACCTGCTCTGGGTGG No data
985775666_985775671 -5 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775671 5:1840547-1840569 GTGTCGGCACCTGCTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985775671 Original CRISPR GTGTCGGCACCTGCTCTGGG TGG Intergenic
No off target data available for this crispr