ID: 985775674

View in Genome Browser
Species Human (GRCh38)
Location 5:1840577-1840599
Sequence CCCCAGAATTTACATCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985775672_985775674 -2 Left 985775672 5:1840556-1840578 CCTGCTCTGGGTGGATAGTGTCC No data
Right 985775674 5:1840577-1840599 CCCCAGAATTTACATCCACCTGG No data
985775666_985775674 25 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775674 5:1840577-1840599 CCCCAGAATTTACATCCACCTGG No data
985775668_985775674 20 Left 985775668 5:1840534-1840556 CCTTGGGACGAGTGTGTCGGCAC No data
Right 985775674 5:1840577-1840599 CCCCAGAATTTACATCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985775674 Original CRISPR CCCCAGAATTTACATCCACC TGG Intergenic
No off target data available for this crispr